EnhancerDB
  1. Home
  2. Enhancers
  3. vista12097[chr11:128420960-128421096]
View enhancers around input chromosomal region
Back to top

Input Chromosomal region, for example: chr1:1000-10000 to view the enhancers around this region

Chromosome characteristics of vista12097[chr11:128420960-128421096]
Back to top
Tissue distribution of vista12097
Back to top
Transcription factor that possibly regulate vista12097[chr11:128420960-128421096]
Back to top
Chrom. Start End TF Name Source Predicted site? Tissue/Cell line id More
chr11 128420945 128420963 NR3C1 JASPAR yes 42317215
chr11 128420945 128420963 NR3C1 JASPAR yes 114155682
chr11 128420961 128420975 TCF7L2 JASPAR yes 42317216
chr11 128420961 128420975 TCF7L2 JASPAR yes 114155683
chr11 128420961 128420976 LEF1 JASPAR yes 42317217
chr11 128420961 128420976 LEF1 JASPAR yes 114155684
chr11 128420966 128420972 SOX10 JASPAR yes 42317218
chr11 128420966 128420972 SOX10 JASPAR yes 114155685
chr11 128420991 128421006 STAT2 JASPAR yes 42317219
chr11 128420991 128421006 STAT2 JASPAR yes 114155686
chr11 128421000 128421015 AR JASPAR yes 42317220
chr11 128421000 128421015 AR JASPAR yes 114155687
chr11 128421011 128421032 ZNF263 JASPAR yes 42317221
chr11 128421011 128421032 ZNF263 JASPAR yes 114155688
chr11 128421014 128421035 ZNF263 JASPAR yes 42317222
chr11 128421014 128421035 ZNF263 JASPAR yes 114155689
chr11 128421015 128421036 ZNF263 JASPAR yes 42317223
chr11 128421015 128421036 ZNF263 JASPAR yes 114155690
chr11 128421066 128421081 RUNX2 JASPAR yes 42317224
chr11 128421066 128421081 RUNX2 JASPAR yes 114155691
chr11 128421067 128421076 RUNX2 JASPAR yes 42317225
chr11 128421067 128421076 RUNX2 JASPAR yes 114155692
chr11 128421067 128421077 RUNX3 JASPAR yes 42317226
chr11 128421067 128421077 RUNX3 JASPAR yes 114155693
chr11 128421067 128421078 RUNX1 JASPAR yes 42317227
chr11 128421067 128421078 RUNX1 JASPAR yes 114155694
chr11 128421084 128421098 FOXF2 JASPAR yes 42317228
chr11 128421084 128421098 FOXF2 JASPAR yes 114155695
chr11 128421085 128421096 FOXA1 JASPAR yes 42317229
chr11 128421085 128421096 FOXH1 JASPAR yes 42317230
chr11 128421085 128421096 FOXA1 JASPAR yes 114155696
chr11 128421085 128421096 FOXH1 JASPAR yes 114155697
chr11 128421086 128421097 FOXC1 JASPAR yes 42317231
chr11 128421086 128421097 FOXC1 JASPAR yes 114155698
chr11 128421086 128421098 FOXC2 JASPAR yes 42317232
chr11 128421086 128421098 FOXC2 JASPAR yes 114155699
chr11 128421089 128421097 FOXG1 JASPAR yes 42317233
chr11 128421089 128421097 FOXG1 JASPAR yes 114155700
chr11 128421094 128421098 YY1 TRANSFAC yes 42317234
chr11 128421094 128421098 YY1 TRANSFAC yes 114155701
SNP sites on vista12097[chr11:128420960-128421096]
Back to top
chrom Position dbSNP ID Reference Allele Alternative Allele is SNP in TFBS id More
chr11 128420981 rs541019560 ACACACCCTTTAGAAAAGAAAAG A no 2357800
chr11 128421078 rs189009644 C A,G,T
RUNX1 RUNX2
2357801
chr11 128421083 rs12417306 C T no 2357802
Genes possibly regulated by vista12097[chr11:128420960-128421096]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance between enhancer and TSS id More
chr11 128328656 128457453 - ETS1 ENSG00000134954.10 128457453 0.91 0.99 11625 63643
Expression level of Genes
Back to top
miRNAs possibly regulated by vista12097[chr11:128420960-128421096]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand miRNA Name miRBase ID TSS Score TSI of Normal tissues TSI of Cancer tissues id More
Expression level of miRNAs
Back to top
No results