EnhancerDB
  1. Home
  2. Enhancers
  3. vista18331[chr14:70161683-70161933]
View enhancers around input chromosomal region
Back to top

Input Chromosomal region, for example: chr1:1000-10000 to view the enhancers around this region

Chromosome characteristics of vista18331[chr14:70161683-70161933]
Back to top
Tissue distribution of vista18331
Back to top
Transcription factor that possibly regulate vista18331[chr14:70161683-70161933]
Back to top
Chrom. Start End TF Name Source Predicted site? Tissue/Cell line id More
chr14 70161685 70161696 E2F6 JASPAR yes 107575658
chr14 70161685 70161696 E2F6 JASPAR yes 116322934
chr14 70161760 70161765 ETS2 TRANSFAC yes 107575659
chr14 70161760 70161765 ETS2 TRANSFAC yes 116322935
chr14 70161766 70161777 EBF1 JASPAR yes 107575660
chr14 70161766 70161777 EBF1 JASPAR yes 116322936
chr14 70161767 70161778 EBF1 JASPAR yes 107575661
chr14 70161767 70161778 EBF1 JASPAR yes 116322937
chr14 70161799 70161810 FLI1 JASPAR yes 107575662
chr14 70161799 70161810 FLI1 JASPAR yes 116322938
chr14 70161800 70161810 GABPA JASPAR yes 107575663
chr14 70161800 70161810 GABPA JASPAR yes 116322939
chr14 70161800 70161813 ELF1 JASPAR yes 107575664
chr14 70161800 70161813 ELF1 JASPAR yes 116322940
chr14 70161806 70161810 NFE TRANSFAC yes 107575665
chr14 70161806 70161810 NFE TRANSFAC yes 116322941
chr14 70161806 70161819 SMAD2 JASPAR yes 107575666
chr14 70161806 70161819 SMAD2 JASPAR yes 116322942
chr14 70161814 70161825 STAT1 JASPAR yes 107575667
chr14 70161814 70161825 STAT3 JASPAR yes 107575668
chr14 70161814 70161825 STAT1 JASPAR yes 116322943
chr14 70161814 70161825 STAT3 JASPAR yes 116322944
chr14 70161839 70161846 SPIB JASPAR yes 107575669
chr14 70161839 70161846 SPIB JASPAR yes 116322945
chr14 70161840 70161848 EHF JASPAR yes 107575670
chr14 70161840 70161848 EHF JASPAR yes 116322946
chr14 70161874 70161885 E2F6 JASPAR yes 107575671
chr14 70161874 70161885 E2F6 JASPAR yes 116322947
chr14 70161882 70161898 SOX8 JASPAR yes 107575672
chr14 70161882 70161898 SOX8 JASPAR yes 116322948
chr14 70161909 70161913 YY1 TRANSFAC yes 107575673
chr14 70161909 70161913 YY1 TRANSFAC yes 116322949
chr14 70161910 70161924 E2F7 JASPAR yes 107575674
chr14 70161910 70161924 E2F7 JASPAR yes 116322950
chr14 70161911 70161919 E2F1 JASPAR yes 107575675
chr14 70161911 70161919 E2F1 JASPAR yes 116322951
chr14 70161914 70161919 SP1 TRANSFAC yes 107575676
chr14 70161914 70161919 SP1 TRANSFAC yes 116322952
chr14 70161923 70161928 ETS2 TRANSFAC yes 107575677
chr14 70161923 70161928 ETS2 TRANSFAC yes 116322953
SNP sites on vista18331[chr14:70161683-70161933]
Back to top
chrom Position dbSNP ID Reference Allele Alternative Allele is SNP in TFBS id More
chr14 70161830 rs544315862 GTCTCATAGGAGAGGAAGGTTGCAAATGGCATGAGAAACCA G no 3635992
chr14 70161910 rs75892139 T G
E2F7 YY1
3635993
Genes possibly regulated by vista18331[chr14:70161683-70161933]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance between enhancer and TSS id More
chr14 70078313 70181859 + KIAA0247 ENSG00000100647.7 70078313 0.74 0.99 13433 16630
chr14 70193617 70238722 + SRSF5 ENSG00000100650.11 70193617 0.7 0.99 13434 68316
Expression level of Genes
Back to top
miRNAs possibly regulated by vista18331[chr14:70161683-70161933]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand miRNA Name miRBase ID TSS Score TSI of Normal tissues TSI of Cancer tissues id More
Expression level of miRNAs
Back to top
No results