EnhancerDB
  1. Home
  2. Enhancers
  3. vista22093[chr16:20271496-20271863]
View enhancers around input chromosomal region
Back to top

Input Chromosomal region, for example: chr1:1000-10000 to view the enhancers around this region

Chromosome characteristics of vista22093[chr16:20271496-20271863]
Back to top
Tissue distribution of vista22093
Back to top
Transcription factor that possibly regulate vista22093[chr16:20271496-20271863]
Back to top
Chrom. Start End TF Name Source Predicted site? Tissue/Cell line id More
chr16 20271499 20271509 RORA JASPAR yes 49352765
chr16 20271507 20271510 MYB TRANSFAC yes 49352766
chr16 20271522 20271539 BCL6B JASPAR yes 49352767
chr16 20271533 20271548 STAT1 JASPAR yes 49352768
chr16 20271535 20271546 STAT1 JASPAR yes 49352769
chr16 20271535 20271546 STAT3 JASPAR yes 49352770
chr16 20271539 20271547 FEV JASPAR yes 49352771
chr16 20271539 20271552 NFKB1 JASPAR yes 49352772
chr16 20271539 20271552 NFKB2 JASPAR yes 49352773
chr16 20271540 20271551 NFKB1 JASPAR yes 49352774
chr16 20271541 20271551 NFKB1 JASPAR yes 49352775
chr16 20271541 20271551 RELA JASPAR yes 49352776
chr16 20271541 20271551 REL JASPAR yes 49352777
chr16 20271546 20271552 MZF1 JASPAR yes 49352778
chr16 20271553 20271557 ESR1 TRANSFAC yes 49352779
chr16 20271562 20271577 RUNX2 JASPAR yes 49352780
chr16 20271566 20271582 T JASPAR yes 49352781
chr16 20271597 20271610 ELF1 JASPAR yes 49352782
chr16 20271598 20271605 SPI1 JASPAR yes 49352783
chr16 20271598 20271606 FEV JASPAR yes 49352784
chr16 20271600 20271605 ETS2 TRANSFAC yes 49352785
chr16 20271617 20271621 NFE TRANSFAC yes 49352786
chr16 20271621 20271632 FOXA1 JASPAR yes 49352787
chr16 20271621 20271636 FOXA1 JASPAR yes 49352788
chr16 20271676 20271679 MYB TRANSFAC yes 49352789
chr16 20271696 20271714 NFYA JASPAR yes 49352790
chr16 20271708 20271712 H4TF2 TRANSFAC yes 49352791
chr16 20271748 20271759 ETV2 JASPAR yes 49352792
chr16 20271749 20271756 SPIB JASPAR yes 49352793
chr16 20271749 20271759 ETV6 JASPAR yes 49352794
chr16 20271749 20271760 FLI1 JASPAR yes 49352795
chr16 20271750 20271758 FEV JASPAR yes 49352796
chr16 20271779 20271791 POU2F1 JASPAR yes 49352797
chr16 20271779 20271792 POU3F3 JASPAR yes 49352798
chr16 20271779 20271793 POU1F1 JASPAR yes 49352799
chr16 20271780 20271792 POU3F1 JASPAR yes 49352800
chr16 20271780 20271792 POU3F2 JASPAR yes 49352801
chr16 20271780 20271793 POU2F2 JASPAR yes 49352802
chr16 20271781 20271789 FOXL1 JASPAR yes 49352803
chr16 20271781 20271790 POU3F4 JASPAR yes 49352804
chr16 20271781 20271790 POU5F1B JASPAR yes 49352805
chr16 20271781 20271792 FOXB1 JASPAR yes 49352806
chr16 20271800 20271810 NFIA JASPAR yes 49352807
chr16 20271801 20271810 NFIX JASPAR yes 49352808
chr16 20271802 20271808 NFIC JASPAR yes 49352809
chr16 20271806 20271817 ETV2 JASPAR yes 49352810
chr16 20271807 20271817 ERF JASPAR yes 49352811
chr16 20271807 20271817 ERG JASPAR yes 49352812
chr16 20271807 20271817 ETS1 JASPAR yes 49352813
chr16 20271807 20271817 FLI1 JASPAR yes 49352814
chr16 20271808 20271816 FEV JASPAR yes 49352815
chr16 20271809 20271820 NFKB1 JASPAR yes 49352816
chr16 20271815 20271829 PLAG1 JASPAR yes 49352817
chr16 20271815 20271830 NR2C2 JASPAR yes 49352818
chr16 20271828 20271837 PITX3 JASPAR yes 49352819
chr16 20271828 20271838 GSC JASPAR yes 49352820
chr16 20271829 20271837 RHOXF1 JASPAR yes 49352821
chr16 20271830 20271840 PAX3 JASPAR yes 49352822
chr16 20271830 20271840 PAX7 JASPAR yes 49352823
chr16 20271835 20271839 YY1 TRANSFAC yes 49352824
chr16 20271835 20271846 CEBPB JASPAR yes 49352825
chr16 20271836 20271847 CEBPA JASPAR yes 49352826
chr16 20271839 20271851 TAL1 JASPAR yes 49352827
chr16 20271840 20271852 BHLHE23 JASPAR yes 49352828
chr16 20271841 20271851 BHLHE22 JASPAR yes 49352829
chr16 20271841 20271851 NEUROD2 JASPAR yes 49352830
chr16 20271841 20271851 NEUROG2 JASPAR yes 49352831
chr16 20271841 20271851 OLIG1 JASPAR yes 49352832
chr16 20271841 20271851 OLIG2 JASPAR yes 49352833
chr16 20271841 20271851 OLIG3 JASPAR yes 49352834
SNP sites on vista22093[chr16:20271496-20271863]
Back to top
chrom Position dbSNP ID Reference Allele Alternative Allele is SNP in TFBS id More
chr16 20271629 rs535092596 A G
FOXA1
4365611
chr16 20271668 rs147064927 C T no 4365612
chr16 20271676 rs183476319 G A
MYB
4365613
chr16 20271720 rs74901544 T C no 4365614
chr16 20271734 rs377347377 C T no 4365615
chr16 20271795 rs368701199 CTGGTGCCTTGGCACAGGAAATCCCT C no 4365616
chr16 20271795 rs372159422 CTGGTGCCTTGGCACAGGAAATCCCT C no 4365617
Genes possibly regulated by vista22093[chr16:20271496-20271863]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance between enhancer and TSS id More
chr16 20320894 20339130 - GP2 ENSG00000169347.12 20339130 1.0 0.94 14608 32733
chr16 20344374 20367623 - UMOD ENSG00000169344.11 20367623 1.0 0.0 14609 4240
Expression level of Genes
Back to top
miRNAs possibly regulated by vista22093[chr16:20271496-20271863]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand miRNA Name miRBase ID TSS Score TSI of Normal tissues TSI of Cancer tissues id More
Expression level of miRNAs
Back to top
No results