EnhancerDB
  1. Home
  2. Enhancers
  3. vista23787[chr17:4422757-4422984]
View enhancers around input chromosomal region
Back to top

Input Chromosomal region, for example: chr1:1000-10000 to view the enhancers around this region

Chromosome characteristics of vista23787[chr17:4422757-4422984]
Back to top
Tissue distribution of vista23787
Back to top
Transcription factor that possibly regulate vista23787[chr17:4422757-4422984]
Back to top
Chrom. Start End TF Name Source Predicted site? Tissue/Cell line id More
chr17 4422757 4422778 ZNF263 JASPAR yes 21187841
chr17 4422757 4422778 ZNF263 JASPAR yes 52845879
chr17 4422761 4422768 CEBPA TRANSFAC yes 21187842
chr17 4422761 4422768 CEBPA TRANSFAC yes 52845880
chr17 4422762 4422773 E2F6 JASPAR yes 21187843
chr17 4422762 4422773 E2F6 JASPAR yes 52845881
chr17 4422775 4422794 REST JASPAR yes 21187844
chr17 4422775 4422794 REST JASPAR yes 52845882
chr17 4422787 4422802 TFAP2A JASPAR yes 21187845
chr17 4422787 4422802 TFAP2A JASPAR yes 52845883
chr17 4422788 4422799 TFAP2A JASPAR yes 21187846
chr17 4422788 4422799 TFAP2B JASPAR yes 21187847
chr17 4422788 4422799 TFAP2C JASPAR yes 21187848
chr17 4422788 4422799 TFAP2A JASPAR yes 52845884
chr17 4422788 4422799 TFAP2B JASPAR yes 52845885
chr17 4422788 4422799 TFAP2C JASPAR yes 52845886
chr17 4422789 4422798 TFAP2A JASPAR yes 21187849
chr17 4422789 4422798 TFAP2A JASPAR yes 52845887
chr17 4422798 4422803 SP1 TRANSFAC yes 21187850
chr17 4422798 4422803 SP1 TRANSFAC yes 52845888
chr17 4422799 4422804 SP1 TRANSFAC yes 21187851
chr17 4422799 4422804 SP1 TRANSFAC yes 52845889
chr17 4422802 4422817 ESR2 JASPAR yes 21187852
chr17 4422802 4422817 ESR2 JASPAR yes 52845890
chr17 4422805 4422815 SREBF2 JASPAR yes 21187853
chr17 4422805 4422815 SREBF2 JASPAR yes 52845891
chr17 4422814 4422820 SP1 TRANSFAC yes 21187854
chr17 4422814 4422820 SP1 TRANSFAC yes 52845892
chr17 4422814 4422824 SP1 JASPAR yes 21187855
chr17 4422814 4422824 SP1 JASPAR yes 52845893
chr17 4422815 4422826 E2F6 JASPAR yes 21187856
chr17 4422815 4422826 E2F6 JASPAR yes 52845894
chr17 4422827 4422835 MEIS2 JASPAR yes 21187857
chr17 4422827 4422835 MEIS3 JASPAR yes 21187858
chr17 4422827 4422835 MEIS2 JASPAR yes 52845895
chr17 4422827 4422835 MEIS3 JASPAR yes 52845896
chr17 4422828 4422832 NFE TRANSFAC yes 21187859
chr17 4422828 4422832 NFE TRANSFAC yes 52845897
chr17 4422848 4422868 ESR1 JASPAR yes 21187860
chr17 4422848 4422868 ESR1 JASPAR yes 52845898
chr17 4422850 4422869 PAX5 JASPAR yes 21187861
chr17 4422850 4422869 PAX5 JASPAR yes 52845899
chr17 4422853 4422867 TLX1 JASPAR yes 21187862
chr17 4422853 4422867 TLX1 JASPAR yes 52845900
chr17 4422866 4422887 REST JASPAR yes 21187863
chr17 4422866 4422887 REST JASPAR yes 52845901
chr17 4422874 4422883 SOX9 JASPAR yes 21187864
chr17 4422874 4422883 SOX9 JASPAR yes 52845902
chr17 4422906 4422920 ZIC1 JASPAR yes 21187865
chr17 4422906 4422920 ZIC1 JASPAR yes 52845903
chr17 4422911 4422918 PEA3 TRANSFAC yes 21187866
chr17 4422911 4422918 PEA3 TRANSFAC yes 52845904
chr17 4422917 4422932 TFAP2C JASPAR yes 21187867
chr17 4422917 4422932 TFAP2C JASPAR yes 52845905
chr17 4422928 4422943 STAT1 JASPAR yes 21187868
chr17 4422928 4422943 STAT1 JASPAR yes 52845906
chr17 4422930 4422941 STAT1 JASPAR yes 21187869
chr17 4422930 4422941 STAT3 JASPAR yes 21187870
chr17 4422930 4422941 STAT1 JASPAR yes 52845907
chr17 4422930 4422941 STAT3 JASPAR yes 52845908
chr17 4422936 4422946 REL JASPAR yes 21187871
chr17 4422936 4422946 REL JASPAR yes 52845909
chr17 4422942 4422947 SP1 TRANSFAC yes 21187872
chr17 4422942 4422947 SP1 TRANSFAC yes 52845910
chr17 4422942 4422948 SP1 TRANSFAC yes 21187873
chr17 4422942 4422948 SP1 TRANSFAC yes 52845911
chr17 4422962 4422967 SP1 TRANSFAC yes 21187874
chr17 4422962 4422967 SP1 TRANSFAC yes 52845912
chr17 4422977 4422986 THAP1 JASPAR yes 21187875
chr17 4422977 4422986 THAP1 JASPAR yes 52845913
SNP sites on vista23787[chr17:4422757-4422984]
Back to top
chrom Position dbSNP ID Reference Allele Alternative Allele is SNP in TFBS id More
chr17 4422802 rs534521892 C A,T
ESR2 SP1 TFAP2A
4713542
chr17 4422900 rs148995586 G GCACACGTGAGCTGAGCGAGGGCTTCCC no 4713543
chr17 4422900 rs71147065 G GCACACGTGAGCTGAGCGAGGGCTTCCC no 4713544
chr17 4422969 rs548194886 G A no 4713545
Genes possibly regulated by vista23787[chr17:4422757-4422984]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance between enhancer and TSS id More
chr17 4336983 4391503 + SPNS3 ENSG00000182557.3 4336983 0.93 1.0 15275 14226
chr17 4402133 4442330 + SPNS2 ENSG00000183018.4 4402133 0.84 1.0 15276 79376
chr17 4442192 4458926 - MYBBP1A ENSG00000132382.10 4458926 0.73 1.0 15277 64058
chr17 4460222 4464113 - GGT6 ENSG00000167741.6 4464113 0.87 0.98 15278 58871
chr17 4487294 4511614 + SMTNL2 ENSG00000188176.7 4487294 0.97 1.0 15279 35690
Expression level of Genes
Back to top
miRNAs possibly regulated by vista23787[chr17:4422757-4422984]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand miRNA Name miRBase ID TSS Score TSI of Normal tissues TSI of Cancer tissues id More
Expression level of miRNAs
Back to top
No results