EnhancerDB
  1. Home
  2. Enhancers
  3. vista31929[chr2:69012672-69013051]
View enhancers around input chromosomal region
Back to top

Input Chromosomal region, for example: chr1:1000-10000 to view the enhancers around this region

Chromosome characteristics of vista31929[chr2:69012672-69013051]
Back to top
Tissue distribution of vista31929
Back to top
Transcription factor that possibly regulate vista31929[chr2:69012672-69013051]
Back to top
Chrom. Start End TF Name Source Predicted site? Tissue/Cell line id More
chr2 69012679 69012691 INSM1 JASPAR yes 22076758
chr2 69012692 69012696 LFA1 TRANSFAC yes 22076759
chr2 69012725 69012734 SOX9 JASPAR yes 22076760
chr2 69012738 69012743 ETS2 TRANSFAC yes 22076761
chr2 69012747 69012758 CEBPA JASPAR yes 22076762
chr2 69012801 69012809 RHOXF1 JASPAR yes 22076763
chr2 69012820 69012826 MZF1 JASPAR yes 22076764
chr2 69012837 69012847 MZF1 JASPAR yes 22076765
chr2 69012842 69012847 ETS2 TRANSFAC yes 22076766
chr2 69012851 69012855 H4TF2 TRANSFAC yes 22076767
chr2 69012866 69012869 MYB TRANSFAC yes 22076768
chr2 69012869 69012873 YY1 TRANSFAC yes 22076769
chr2 69012905 69012918 POU3F3 JASPAR yes 22076770
chr2 69012931 69012935 H4TF2 TRANSFAC yes 22076771
chr2 69012935 69012939 YY1 TRANSFAC yes 22076772
chr2 69012965 69012968 MYB TRANSFAC yes 22076773
chr2 69012965 69012975 MAX JASPAR yes 22076774
chr2 69012965 69012980 SCRT1 JASPAR yes 22076775
chr2 69012966 69012976 CLOCK JASPAR yes 22076776
chr2 69012966 69012976 MYF6 JASPAR yes 22076777
chr2 69012966 69012976 NEUROG2 JASPAR yes 22076778
chr2 69012995 69013011 POU4F3 JASPAR yes 22076779
chr2 69012997 69013011 POU4F1 JASPAR yes 22076780
chr2 69013005 69013020 TFAP2A JASPAR yes 22076781
chr2 69013011 69013024 NR2F1 JASPAR yes 22076782
chr2 69013012 69013020 CREB1 JASPAR yes 22076783
chr2 69013013 69013027 RXRB JASPAR yes 22076784
chr2 69013013 69013027 RXRG JASPAR yes 22076785
chr2 69013015 69013019 ESR1 TRANSFAC yes 22076786
chr2 69013037 69013043 LEF1 TRANSFAC yes 22076787
chr2 69013037 69013043 SOX10 JASPAR yes 22076788
SNP sites on vista31929[chr2:69012672-69013051]
Back to top
chrom Position dbSNP ID Reference Allele Alternative Allele is SNP in TFBS id More
chr2 69012708 rs147836032 A G no 5824175
chr2 69012727 rs555663049 C CATTGTACTGGTAAGGAAACTATTGCTCAAG
SOX9
5824176
chr2 69012839 rs74411026 T C,G
MZF1
5824177
chr2 69012846 rs11682171 A T
ETS2 MZF1
5824178
chr2 69012963 rs78327672 G A no 5824179
chr2 69013007 rs11677065 T C
POU4F1 POU4F3 TFAP2A
5824180
Genes possibly regulated by vista31929[chr2:69012672-69013051]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance between enhancer and TSS id More
chr2 69092613 69098649 - BMP10 ENSG00000163217.1 69098649 1.0 1.0 2420 14402
Expression level of Genes
Back to top
miRNAs possibly regulated by vista31929[chr2:69012672-69013051]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand miRNA Name miRBase ID TSS Score TSI of Normal tissues TSI of Cancer tissues id More
Expression level of miRNAs
Back to top
No results