EnhancerDB
  1. Home
  2. Enhancers
  3. vista32941[chr2:121523492-121523901]
View enhancers around input chromosomal region
Back to top

Input Chromosomal region, for example: chr1:1000-10000 to view the enhancers around this region

Chromosome characteristics of vista32941[chr2:121523492-121523901]
Back to top
Tissue distribution of vista32941
Back to top
Transcription factor that possibly regulate vista32941[chr2:121523492-121523901]
Back to top
Chrom. Start End TF Name Source Predicted site? Tissue/Cell line id More
chr2 121523571 121523747 CEBPB UCSC Txn Factor no Conserved 108433789
chr2 121523493 121523503 TEAD1 JASPAR yes 22122598
chr2 121523493 121523503 TEAD4 JASPAR yes 22122599
chr2 121523493 121523503 TEAD1 JASPAR yes 76571320
chr2 121523493 121523503 TEAD4 JASPAR yes 76571321
chr2 121523543 121523547 YY1 TRANSFAC yes 22122600
chr2 121523543 121523547 YY1 TRANSFAC yes 76571322
chr2 121523558 121523561 MYB TRANSFAC yes 22122601
chr2 121523558 121523561 MYB TRANSFAC yes 76571323
chr2 121523563 121523574 FOXP2 JASPAR yes 22122602
chr2 121523563 121523574 FOXP2 JASPAR yes 76571324
chr2 121523570 121523578 FOXO3 JASPAR yes 22122603
chr2 121523570 121523578 FOXO3 JASPAR yes 76571325
chr2 121523588 121523597 THAP1 JASPAR yes 22122604
chr2 121523588 121523597 THAP1 JASPAR yes 76571326
chr2 121523591 121523595 LFA1 TRANSFAC yes 22122605
chr2 121523591 121523595 LFA1 TRANSFAC yes 76571327
chr2 121523633 121523648 ZBTB33 JASPAR yes 22122606
chr2 121523633 121523648 ZBTB33 JASPAR yes 76571328
chr2 121523655 121523660 ETS2 TRANSFAC yes 22122607
chr2 121523655 121523660 ETS2 TRANSFAC yes 76571329
chr2 121523657 121523670 ATF4 JASPAR yes 22122608
chr2 121523657 121523670 ATF4 JASPAR yes 76571330
chr2 121523667 121523677 MZF1 JASPAR yes 22122609
chr2 121523667 121523677 MZF1 JASPAR yes 76571331
chr2 121523670 121523675 TFAP2A TRANSFAC yes 22122610
chr2 121523670 121523675 TFAP2A TRANSFAC yes 76571332
chr2 121523670 121523676 MZF1 JASPAR yes 22122611
chr2 121523670 121523676 MZF1 JASPAR yes 76571333
chr2 121523670 121523680 SP1 JASPAR yes 22122612
chr2 121523670 121523680 SP1 JASPAR yes 76571334
chr2 121523672 121523678 MAZ TRANSFAC yes 22122613
chr2 121523672 121523678 MAZ TRANSFAC yes 76571335
chr2 121523676 121523694 RARA JASPAR yes 22122614
chr2 121523676 121523694 RARA JASPAR yes 76571336
chr2 121523703 121523713 SP1 JASPAR yes 22122615
chr2 121523703 121523713 SP1 JASPAR yes 76571337
chr2 121523718 121523723 GATA2 JASPAR yes 22122616
chr2 121523718 121523723 GATA2 JASPAR yes 76571338
chr2 121523762 121523770 NR4A2 JASPAR yes 22122617
chr2 121523762 121523770 NR4A2 JASPAR yes 76571339
chr2 121523779 121523783 H4TF2 TRANSFAC yes 22122618
chr2 121523779 121523783 H4TF2 TRANSFAC yes 76571340
chr2 121523779 121523792 ZBTB18 JASPAR yes 22122619
chr2 121523779 121523792 ZBTB18 JASPAR yes 76571341
chr2 121523782 121523795 SCRT2 JASPAR yes 22122620
chr2 121523782 121523795 SCRT2 JASPAR yes 76571342
chr2 121523787 121523799 E2F1 JASPAR yes 22122621
chr2 121523787 121523799 E2F1 JASPAR yes 76571343
chr2 121523814 121523829 STAT1 JASPAR yes 22122622
chr2 121523814 121523829 STAT1 JASPAR yes 76571344
chr2 121523816 121523827 STAT1 JASPAR yes 22122623
chr2 121523816 121523827 STAT1 JASPAR yes 76571345
chr2 121523818 121523829 ELF5 JASPAR yes 22122624
chr2 121523818 121523829 ELF5 JASPAR yes 76571346
chr2 121523819 121523830 ELK4 JASPAR yes 22122625
chr2 121523819 121523830 ELK4 JASPAR yes 76571347
chr2 121523820 121523828 FEV JASPAR yes 22122626
chr2 121523820 121523828 FEV JASPAR yes 76571348
chr2 121523844 121523855 ELK4 JASPAR yes 22122627
chr2 121523844 121523855 FLI1 JASPAR yes 22122628
chr2 121523844 121523855 ELK4 JASPAR yes 76571349
chr2 121523844 121523855 FLI1 JASPAR yes 76571350
chr2 121523845 121523855 ERF JASPAR yes 22122629
chr2 121523845 121523855 ETS1 JASPAR yes 22122630
chr2 121523845 121523855 ETV6 JASPAR yes 22122631
chr2 121523845 121523855 GABPA JASPAR yes 22122632
chr2 121523845 121523855 ERF JASPAR yes 76571351
chr2 121523845 121523855 ETS1 JASPAR yes 76571352
chr2 121523845 121523855 ETV6 JASPAR yes 76571353
chr2 121523845 121523855 GABPA JASPAR yes 76571354
chr2 121523845 121523858 ELF1 JASPAR yes 22122633
chr2 121523845 121523858 ELF1 JASPAR yes 76571355
chr2 121523846 121523853 SPI1 JASPAR yes 22122634
chr2 121523846 121523853 SPI1 JASPAR yes 76571356
chr2 121523846 121523854 EHF JASPAR yes 22122635
chr2 121523846 121523854 FEV JASPAR yes 22122636
chr2 121523846 121523854 EHF JASPAR yes 76571357
chr2 121523846 121523854 FEV JASPAR yes 76571358
SNP sites on vista32941[chr2:121523492-121523901]
Back to top
chrom Position dbSNP ID Reference Allele Alternative Allele is SNP in TFBS id More
chr2 121523586 rs531383876 CTCTGTGGGCAAGGTCTCGGAGACG C
CEBPB
5994234
chr2 121523653 rs80101048 T C
CEBPB
5994235
chr2 121523779 rs77110910 C T
H4TF2 ZBTB18
5994236
chr2 121523784 rs151206286 C T
SCRT2 ZBTB18
5994237
chr2 121523785 rs140978484 A G
SCRT2 ZBTB18
5994238
chr2 121523844 rs57665692 G A
ELK4 FLI1
5994239
Genes possibly regulated by vista32941[chr2:121523492-121523901]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance between enhancer and TSS id More
chr2 121493199 121750229 + GLI2 ENSG00000074047.16 121493199 0.89 0.99 2733 69707
Expression level of Genes
Back to top
miRNAs possibly regulated by vista32941[chr2:121523492-121523901]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand miRNA Name miRBase ID TSS Score TSI of Normal tissues TSI of Cancer tissues id More
Expression level of miRNAs
Back to top
No results