Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 13879925 13886435 enh91664

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 13880581 rs539323842 ATTGGTCAGCTCAAACGTGCGTGGGAGCTGTT A 8847684

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results