Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 17199488 17204096 enh46090

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 17201372 rs188702998 A C,G 8875818
chr6 17201372 rs562718000 A ATGGACCAATCAGCACTCTGTCAAAG 8875819

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results