Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 25438305 25445175 enh49069

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 25442846 rs372177933 ATAGATAAGAAACAGTTCCTACCT A 8923284
chr6 25442846 rs548773322 ATAGATAAGAAACAGTTCCTACCT A 8923285

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results