| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr6 | 29260045 | 29265595 | enh84143 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr6 | 29264404 | rs371308120 | A | AATTCCTTTTCCTGGCTCATCC,ATCC | 8939766 | |
| chr6 | 29264404 | rs41264406 | A | AATTCCTTTTCCTGGCTCATCC | 8939767 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|