Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 32397701 32402179 enh61379

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 32398917 rs6149520 GTATACACATATACCATATGACA G 8961417
chr6 32398917 rs879001935 GTATACACATATACCATATGACA G 8961418

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results