| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr6 | 34208365 | 34213130 | enh84148 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr6 | 34211110 | rs551262472 | C | CTTGGGTGGGCCTGTTGGGTGAGAGTG | 8979644 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|---|---|---|---|---|---|---|---|---|---|---|
| chr6 | 34208491 | 34208513 | + | hsa-miR-6835-3p | MIMAT0027571 | 34204681 | 0.0 | 0.0 | 6429 | 1373 |