Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 34208365 34213130 enh84148

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 34211110 rs551262472 C CTTGGGTGGGCCTGTTGGGTGAGAGTG 8979644

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr6 34208491 34208513 + hsa-miR-6835-3p MIMAT0027571 34204681 0.0 0.0 6429 1373