Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 37580512 37597189 enh38963

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 37584099 rs9369013 T C 9002582
chr6 37584102 rs149020210 GGCCCCTGCCCATCTCCAGGCAGGTA G 9002583

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results