Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 38143285 38147515 enh95710

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 38144206 rs558069479 TGGGAGCTGCCATTTTCTCTTAGA T 9006830

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results