Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 39109405 39113555 enh108063

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 39111247 rs544963891 T TACAATGAGCAGTGACATTTACA 9010376

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results