Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 40486329 40498055 enh102337

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 40491707 rs542069560 AGAAGGGCAGGGGGAGGGGCTGG A 9019531
chr6 40491707 rs67318315 AGAAGGGCAGGGGGAGGGGCTGG A 9019532

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results