EnhancerDB
  1. Home
  2. TFBS
  3. SP1[chr6:40504027-40504037]
Chromosome characteristics of SP1[chr6:40504027-40504037]
Back to top
Enhancers possibly regulated by SP1[chr6:40504027-40504037]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 40500945 40506435 enh77868
Muscle (A673)
SNP sites on SP1[chr6:40504027-40504037]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 40504030 rs538569602 ACAGCCCCGTCCTCAGGGAGCCC A 9019653
chr6 40504037 rs75709074 C T 9019654
Genes possibly regulated by SP1[chr6:40504027-40504037]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by SP1[chr6:40504027-40504037]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results