Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 27159445 27163595 enh104231

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 27161714 rs370536808 GCTCACTGAACCTCCACCTC G 4393525
chr16 27161714 rs371747466 GCTCACTGAACCTCCACCTC G 4393526

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results