Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 43242582 43248656 enh55756

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 43247746 rs551929506 A AGAAAGCTTTCTAAGAAAACTTTCTAACTAAG 9036560
chr6 43247750 rs146135690 A G 9036561

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results