Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 45165325 45171495 enh77879

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 45166470 rs150810427 T TTTTAATTCTATATACACAG 9048610

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results