Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 46079185 46083335 enh97846

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 46079750 rs143043519 T TTATAAATTAACCAGTCTCAAG 9054877
chr6 46079750 rs71305764 T TTATAAATTAACCAGTCTCAAG 9054878

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results