Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 46183325 46187655 enh49109

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 46184912 rs139986069 CACTCTGAAGTGGGGAGCTGGG C 9055188
chr6 46184912 rs57653146 CACTCTGAAGTGGGGAGCTGGG C 9055189

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results