Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 48100065 48111875 enh23294

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 48103113 rs533487858 CTTTATCTTTTATCTTCTCCTCT C 9065118

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results