Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 28092025 28096255 enh16616

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 28094974 rs553027121 GGGCAGGCTGGTCTCGAACTCCTGACCTCAT G 4398304

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results