Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 29664305 29668455 enh91106

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 29668114 rs151309550 GGGTGGGGAGCCCTGGGGCAGCCACCACA G 4405149
chr16 29668114 rs376031809 GGGTGGGGAGCCCTGGGGCAGCCACCACA G 4405150
chr16 29668116 rs76338569 G A 4405151

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results