Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 30388125 30392275 enh3974

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 30389469 rs570276604 CTCAGTTTTTATTGAAGACAGAGTCTGGG C 4407926

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr16 30389427 30411429 + ZNF48 ENSG00000180035.6 30389427 0.62 1.0 31 14742
chr16 30389755 30393863 - SEPT1 ENSG00000270466.1 30393863 0.96 0.97 4394 14744


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results