Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 82441905 82453835 enh23383

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 82443729 rs573286014 T TAGAAACTAGCTGGTACATTTTGTGCC 9156724

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results