| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr6 | 83759585 | 83767355 | enh9219 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr6 | 83762910 | rs151202525 | C | CAGTTCTTCATCTTCCAGTGTGGCTCAGGGA | 9163182 | |
| chr6 | 83762910 | rs6149671 | C | CAGTTCTTCATCTTCCAGTGTGGCTCAGGGA | 9163183 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|