Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 83759585 83767355 enh9219

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 83762910 rs151202525 C CAGTTCTTCATCTTCCAGTGTGGCTCAGGGA 9163182
chr6 83762910 rs6149671 C CAGTTCTTCATCTTCCAGTGTGGCTCAGGGA 9163183

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results