Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 84077205 84081715 enh77945

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 84079372 rs566523909 GAGGAAGGAAGGAAGGAACGAAGGAAGGAAGGA G 9163689

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results