Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 87185625 87189795 enh55873

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 87187744 rs534937911 GCAGCGTGACTTTCAGTCACGCCTAT G 9172002

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results