Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 88189745 88196686 enh86637

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 88194385 rs141229913 CAGGGTGGAGCAGGTAATTGGAATT C 9174918
chr6 88194385 rs375723186 CAGGGTGGAGCAGGTAATTGGAATT C 9174919

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results