EnhancerDB
  1. Home
  2. TFBS
  3. LEF1[chr6:90680023-90680038]
Chromosome characteristics of LEF1[chr6:90680023-90680038]
Back to top
Enhancers possibly regulated by LEF1[chr6:90680023-90680038]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 90674765 90692455 enh23417
Prostate (PC-3) Brain (SK-N-SH) Lung (PC-9) Astrocyte Placenta Peripheral Blood (MM.1S) Muscle (Myoblast) Pancreas Heart
SNP sites on LEF1[chr6:90680023-90680038]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 90680027 rs370627901 GCTTTGATGATCTTTCCACCTCCTGA G 9184658
chr6 90680027 rs560093104 GCTTTGATGATCTTTCCACCTCCTGA G 9184659
Genes possibly regulated by LEF1[chr6:90680023-90680038]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by LEF1[chr6:90680023-90680038]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results