Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 90674765 90692455 enh23417

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 90680027 rs370627901 GCTTTGATGATCTTTCCACCTCCTGA G 9184658
chr6 90680027 rs560093104 GCTTTGATGATCTTTCCACCTCCTGA G 9184659

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results