EnhancerDB
  1. Home
  2. TFBS
  3. YY1[chr6:107098398-107098402]
Chromosome characteristics of YY1[chr6:107098398-107098402]
Back to top
Enhancers possibly regulated by YY1[chr6:107098398-107098402]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 107094925 107100295 enh9278
Blood (Karpas-422)
SNP sites on YY1[chr6:107098398-107098402]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 107098399 rs142058312 TATTTTTGATTTGTTTACCC T 9236036
chr6 107098400 rs66506413 A C 9236037
Genes possibly regulated by YY1[chr6:107098398-107098402]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by YY1[chr6:107098398-107098402]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results