Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 108803425 108807575 enh94655

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 108803974 rs544233239 G GGAATAGACCACAGAAATCAAGTAC 9246711

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results