Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 109489165 109498375 enh23487

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 109493379 rs555080844 TAATTCTCTCAGCAGACAGAC T 9251635

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results