Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 110942465 110946615 enh84353

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 110944960 rs71021805 TATATATACACATATATATAC T 9258683
chr6 110944966 rs142812633 T C 9258684

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results