Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 134436505 134440655 enh97930

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 134439503 rs148151275 A ATGACCAGGACAATTACAAT 9349847
chr6 134439503 rs376501684 A ATGACCAGGACAATTACAAT 9349848

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results