Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 135403825 135412615 enh49163

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 135409113 rs538642919 C T 9357722
chr6 135409115 rs575127302 AAAGGAAAATAACTTTTTTTTTT A 9357723
chr6 135409116 rs6913541 A G 9357724

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results