Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 98540979 98541355 vista19008

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 98541285 rs556610938 CTGAGCAAGATATTCGTCCCCTCTGAAGGGG C 3772823

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results