EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:5159909-5160508]
Chromosome characteristics of ZNF274[chr1:5159909-5160508]
Back to top
Enhancers possibly regulated by ZNF274[chr1:5159909-5160508]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 5157200 5161924 enh66829
Neural Stem Cells (H9)
chr1 5160051 5160190 vista149
VISTA
SNP sites on ZNF274[chr1:5159909-5160508]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 5159958 rs117673170 G A 30708
chr1 5159996 rs537071350 A C 30709
chr1 5160004 rs556806782 T G 30710
chr1 5160058 rs72858475 C T 30711
chr1 5160092 rs189051927 T C 30712
chr1 5160351 rs577864641 GGTTTAAAACGACATCTGGCAAAAAGCTTCTCACCAAGA G 30713
chr1 5160360 rs992597 C T 30714
chr1 5160390 rs144904101 G C 30715
chr1 5160392 rs572047724 T C 30716
chr1 5160397 rs140864681 C T 30717
chr1 5160398 rs72858479 G A 30718
chr1 5160476 rs142553813 AG A 30719
Genes possibly regulated by ZNF274[chr1:5159909-5160508]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:5159909-5160508]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results