Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 6315612 6319980 enh42860
chr1 6319998 6320272 vista162

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 6319775 rs111296830 G A 37313
chr1 6319888 rs116302750 A C 37314
chr1 6319898 rs115097550 G A 37315
chr1 6319968 rs551394352 GTCTCCTGCAGGGCACTTAAAGCCCTGTCTTCTGCTGGGAAGTT G 37316
chr1 6320004 rs538349355 G A 37317
chr1 6320006 rs138243241 G T 37318
chr1 6320011 rs184145614 T G 37319
chr1 6320055 rs6663603 C G 37320

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 6307406 6321035 - GPR153 ENSG00000158292.6 6321035 0.72 0.99 895 95


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results