EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr1:19283325-19283995]
Chromosome characteristics of ZNF143[chr1:19283325-19283995]
Back to top
Enhancers possibly regulated by ZNF143[chr1:19283325-19283995]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 19283819 19283997 vista602
VISTA
SNP sites on ZNF143[chr1:19283325-19283995]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 19283353 rs563333721 C A 128464
chr1 19283410 rs1406842 C G 128465
chr1 19283444 rs377524937 GGGACCCGGACCGCAGAGCTGC G 128466
chr1 19283450 rs561042736 C T 128467
chr1 19283557 rs115164734 A G 128468
chr1 19283685 rs147759718 T C 128469
chr1 19283815 rs75214186 G A 128470
chr1 19283822 rs74651467 TC T 128471
Genes possibly regulated by ZNF143[chr1:19283325-19283995]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 19230775 19283180 - IFFO2 ENSG00000169991.6 19283180 0.83 0.99 145 255
Expression level of Genes
Back to top
miRNAs possibly regulated by ZNF143[chr1:19283325-19283995]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results