EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB33[chr1:36349851-36352143]
Chromosome characteristics of ZBTB33[chr1:36349851-36352143]
Back to top
Enhancers possibly regulated by ZBTB33[chr1:36349851-36352143]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 36345625 36353999 enh237
Bone Marrow (K562) Brain (SK-N-SH) Blood (OCI-LY7) Blood (GM12878) Muscle (A673) Blood (Karpas-422)
chr1 36351655 36352020 vista1179
VISTA
SNP sites on ZBTB33[chr1:36349851-36352143]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 36349857 rs1799678 G A 231020
chr1 36349888 rs201304410 A AGACTGGGACCGAAGCGATGGG 231021
chr1 36349897 rs114315295 C T 231022
chr1 36349902 rs116078627 G C 231023
chr1 36350010 rs114696711 G C 231024
chr1 36351030 rs542372648 T C 231025
chr1 36351428 rs148686527 TAAATC T 231026
chr1 36351515 rs528960290 C A 231027
Genes possibly regulated by ZBTB33[chr1:36349851-36352143]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB33[chr1:36349851-36352143]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results