Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 154982565 154986715 enh646
chr1 154986150 154986272 vista3412

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 154986038 rs375054275 GTGCTCTGCACCCACCTCCTGGC G 642460
chr1 154986038 rs561610427 GTGCTCTGCACCCACCTCCTGGC G 642461
chr1 154986091 rs3753639 T C 642462

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results