EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr1:183558473-183559009]
Chromosome characteristics of ZZZ3[chr1:183558473-183559009]
Back to top
Enhancers possibly regulated by ZZZ3[chr1:183558473-183559009]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 183557915 183558504 vista4175
VISTA
SNP sites on ZZZ3[chr1:183558473-183559009]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 183558714 rs529030440 A G 781254
chr1 183558753 rs559012556 A C 781255
chr1 183558781 rs145455213 TAA T 781256
chr1 183558803 rs34194274 G T 781257
chr1 183558820 rs113908540 G T 781258
chr1 183558876 rs191488901 C T 781259
chr1 183558883 rs35648088 CATGAAAGTCTTGGAAAGCCA C 781260
chr1 183558883 rs373646186 CATGAAAGTCTTGGAAAGCCA C 781261
chr1 183558941 rs35394013 G A 781262
chr1 183558989 rs549670383 A C 781263
chr1 183558996 rs34110768 G A 781264
Genes possibly regulated by ZZZ3[chr1:183558473-183559009]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 183524698 183560011 - NCF2 ENSG00000116701.10 183560011 0.92 0.96 1002 1641
Expression level of Genes
Back to top
miRNAs possibly regulated by ZZZ3[chr1:183558473-183559009]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results