Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 204486309 204486424 vista4698

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 204486414 rs139095143 A G 876985
chr1 204486492 rs4252670 A G 876986
chr1 204486522 rs552162961 GTGTTTTTGTTT G 876987
chr1 204486612 rs570318072 ACTTCTGCCTCACGGGTTCAAGTGATT A 876988
chr1 204486793 rs533269955 G A 876989

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 204485511 204542871 + MDM4 ENSG00000198625.8 204485511 0.83 0.99 874 1754


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results