Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 206950405 206967156 enh12598
chr1 206955889 206956132 vista4806

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 206955365 rs66925029 TA T,TGTTATATATACATATATATGTATAT 891000
chr1 206955392 rs573416789 A G,T 891001
chr1 206955408 rs11273390 ATG A 891002
chr1 206955410 rs6669291 G A 891003
chr1 206955634 rs114501584 G T 891004
chr1 206955650 rs79420253 C T 891005
chr1 206955651 rs6686931 T C 891006
chr1 206955659 rs12029006 G A 891007
chr1 206955701 rs6687015 T A 891008
chr1 206955760 rs35946466 TGTAA T 891009
chr1 206955760 rs67901354 TGTAA T 891010
chr1 206955869 rs562455384 G A 891011
chr1 206955995 rs147805012 G A 891012

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results