Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 207821445 207825595 enh90761
chr1 207821800 207821952 vista4838

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 207821718 rs75352843 A G 895393
chr1 207821724 rs370072283 TTAAATCAAGACAGGTATGAAACC T 895394
chr1 207821724 rs370138110 TTAAATCAAGACAGGTATGAAACC T 895395
chr1 207821810 rs145849932 C T 895396
chr1 207821909 rs112550971 T A 895397
chr1 207821919 rs568494824 T G 895398
chr1 207821932 rs10573245 CAT C 895399
chr1 207821959 rs537060559 T C 895400
chr1 207822078 rs6666431 G A 895401
chr1 207822110 rs143956752 C T 895402

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results